| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.196287 |
| Chromosome: | chromosome 10 |
| Location: | 3151628 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441900 | FAP145 | (1 of 1) PF15739 - Translin-associated factor X-interacting N-terminus (TSNAXIP1_N); Flagellar Associated Protein 145 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTCCAGTGGTACTTGTAACAAAAACTC |
| Internal bar code: | GTGATGTACGGTAAACGACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 968 |
| LEAP-Seq percent confirming: | 99.7855 |
| LEAP-Seq n confirming: | 6979 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTGTACGGCCCTGGACTA |
| Suggested primer 2: | CTTGTACAGCTTGCTCGCAG |