| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.196305 |
| Chromosome: | chromosome 11 |
| Location: | 3397603 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480650 | SDR20 | Short-chain dehydrogenase/reductase; (1 of 13) 1.1.1.300 - NADP-retinol dehydrogenase / Retinol dehydrogenase (NADP(+)) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGATGCTGCCGCCGCCCCTCCCCCTGCC |
| Internal bar code: | CGTTAGTGCGGTAGACTCTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 271 |
| LEAP-Seq percent confirming: | 99.5796 |
| LEAP-Seq n confirming: | 6159 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGTCACGTGAAAAAGTTC |
| Suggested primer 2: | CAGCTCCACATTAGGCAACA |