| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.196473 |
| Chromosome: | chromosome 1 |
| Location: | 7303139 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g052650 | APT2,VIP2 | inositol hexakisphosphate kinase; (1 of 2) 2.7.4.21 - Inositol-hexakisphosphate kinase / IP6K | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACAGCCTCCGGCCCTGCTGCTGCTACAT |
| Internal bar code: | AACATTTCGTCTTAAGAACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 261 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCACCTGCCATTACAACA |
| Suggested primer 2: | TACCAACTCACGCCTAACCC |