Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.196479 |
Chromosome: | chromosome 12 |
Location: | 5446181 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g530400 | CrZIP13,IRT1,ZIP11 | Iron-nutrition responsive ZIP family Fe transporter; (1 of 5) K07238 - zinc transporter, ZIP family (TC.ZIP, zupT, ZRT3, ZIP2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCATTACCTCGGGCATCACCACCGCAGT |
Internal bar code: | TAAGCCGTCAGTGGAGCCGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 264 |
LEAP-Seq percent confirming: | 99.8296 |
LEAP-Seq n confirming: | 1758 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGGTGTCATGATGTGTGC |
Suggested primer 2: | CTCAGCATCACCTCCTAGCC |