Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.196516 |
Chromosome: | chromosome 7 |
Location: | 6055268 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g355150 | ZRT5,CrZIP4 | (1 of 6) K14709 - solute carrier family 39 (zinc transporter), member 1/2/3 (SLC39A1_2_3, ZIP1_2_3); Zinc-nutrition responsive transporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCTTCCATATGCAAGGGCCGTCCCTG |
Internal bar code: | ACGGGGGACCGGGACGTCATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 407 |
LEAP-Seq percent confirming: | 98.4273 |
LEAP-Seq n confirming: | 2253 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAAGTTGCATCATTTCT |
Suggested primer 2: | CACCAAACATGTACGCCAAG |