| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.196516 |
| Chromosome: | chromosome 7 |
| Location: | 6055272 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g355150 | ZRT5,CrZIP4 | (1 of 6) K14709 - solute carrier family 39 (zinc transporter), member 1/2/3 (SLC39A1_2_3, ZIP1_2_3); Zinc-nutrition responsive transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTGGAGACGTGGCGCAAGGGAGCCAGA |
| Internal bar code: | TCCTAAGTACTAAGGGTTGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.3666 |
| LEAP-Seq n confirming: | 1255 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCAAGTTGCATCATTTCT |
| Suggested primer 2: | CACCAAACATGTACGCCAAG |