| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.196637 |
| Chromosome: | chromosome 10 |
| Location: | 1834555 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g431150 | FAP256,ROC22,CEP104 | Flagellar Associated Protein 256; (1 of 1) PTHR13371:SF0 - CENTROSOMAL PROTEIN OF 104 KDA | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGCAGCCACGCCGTTGTGCCGCGCACC |
| Internal bar code: | CATGGTCGGGTGCACTTCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 326 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1919 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACAGGGTAGAGCGGGTT |
| Suggested primer 2: | AAGATCAAGGAGCAGGTGGA |