| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.196710 |
| Chromosome: | chromosome 7 |
| Location: | 579380 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316650 | (1 of 1) PF00069//PF03924//PF07714 - Protein kinase domain (Pkinase) // CHASE domain (CHASE) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTTTCGGTGCGCGCTGGCACAAATTGG |
| Internal bar code: | CGCTAGGAAGCGGTGTGACACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 763 |
| LEAP-Seq percent confirming: | 99.3606 |
| LEAP-Seq n confirming: | 10256 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGAGCGCAAGAGTTTGAT |
| Suggested primer 2: | TTCATTCCTGTTGCTGTTGC |