Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.196955 |
Chromosome: | chromosome 3 |
Location: | 2805638 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g162250 | RAD1,CGL35,RAD17 | Conserved in the Green Lineage; (1 of 1) K02830 - cell cycle checkpoint protein (HRAD1, RAD17) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACATTCATGATTCTATGAAAAGTGAAGG |
Internal bar code: | TTAGGGACCGACCATCAGACCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 94 |
LEAP-Seq percent confirming: | 97.8723 |
LEAP-Seq n confirming: | 92 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCGGGATGATACACACAG |
Suggested primer 2: | ACGGTATGTGTGGATGGGAT |