| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197033 |
| Chromosome: | chromosome 7 |
| Location: | 4405142 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340950 | AXL4 | (1 of 6) PTHR10994//PTHR10994:SF61 - RETICULON // RETICULON-LIKE PROTEIN; Arabinose chain extension enzyme like protein 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACGTGCCGGACCACAAGCACCTGCGGGT |
| Internal bar code: | GGGGTTGGTCATGGTGTAACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 58.7798 |
| LEAP-Seq n confirming: | 1108 |
| LEAP-Seq n nonconfirming: | 777 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACTCGGATCACACAGCG |
| Suggested primer 2: | ACTATGCCAACGTTTACCGC |