Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.197043 |
Chromosome: | chromosome 14 |
Location: | 2605416 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625901 | (1 of 3) PF01985 - CRS1 / YhbY (CRM) domain (CRS1_YhbY) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCAGGAAAGCGGGATGGCCCGGCACTG |
Internal bar code: | TCGGAGCTTTCGGGTTTGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 761 |
LEAP-Seq percent confirming: | 99.6705 |
LEAP-Seq n confirming: | 1210 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACAGAGACTCCTGCGGAC |
Suggested primer 2: | TTCTGTTGCTGTTTGACGCT |