| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197077 |
| Chromosome: | chromosome 10 |
| Location: | 1689712 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430200 | ARS3 | Arylsulfatase; (1 of 19) 3.1.6.1 - Arylsulfatase / Sulfatase | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAACGACGGCAGGTCACAGGCGCATAT |
| Internal bar code: | GCGACCTGCAGACATAGTTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1031 |
| LEAP-Seq percent confirming: | 98.5782 |
| LEAP-Seq n confirming: | 2704 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGTACACAGGAGGGTGT |
| Suggested primer 2: | ATTGCGTGCATTGATGTGTT |