| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.197138 |
| Chromosome: | chromosome 3 |
| Location: | 3895425 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g171250 | (1 of 1) IPR000104//IPR011989//IPR012677//IPR013083 - Antifreeze protein, type I // Armadillo-like helical // Nucleotide-binding alpha-beta plait domain // Zinc finger, RING/FYVE/PHD-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCAGGCGCCGTACACGCGCACCACCT |
| Internal bar code: | GCGATAAAGTATTATGGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 24 |
| LEAP-Seq percent confirming: | 99.5876 |
| LEAP-Seq n confirming: | 483 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | TACAGGCAAGAGCAGAGGGT |