| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197143 |
| Chromosome: | chromosome 9 |
| Location: | 2669264 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389900 | HRP4 | Hydroxyproline-rich glycoprotein; (1 of 1) PTHR15744//PTHR15744:SF0 - BLOM7 // UPF0469 PROTEIN KIAA0907 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCTGACTCCCGGCCACCCATTGCTCCT |
| Internal bar code: | CAATGGCACACGGTTGAGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 820 |
| LEAP-Seq percent confirming: | 98.9548 |
| LEAP-Seq n confirming: | 3503 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCTTTCCGGTAGACAGC |
| Suggested primer 2: | GCCAGGCTATCAGCTAAACG |