| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.197174 |
| Chromosome: | chromosome 14 |
| Location: | 883288 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g613550 | HSP70H,FAP203 | Heat shock protein 70H; (1 of 1) PTHR31516:SF11 - PROTEIN H13N06.7-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGGTTTGGCGACCCGGCATCCAGACAT |
| Internal bar code: | CTCCTGCGGCCAGTAGCCGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 99.8483 |
| LEAP-Seq n confirming: | 3948 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTTACACCCCCATCAAGC |
| Suggested primer 2: | TCACAGGAAGTGTCTGCTGG |