| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197189 |
| Chromosome: | chromosome 12 |
| Location: | 5652379 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532350 | CAV8 | (1 of 2) PF00520//PF08016 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel); Voltage-gated Ca2+ channel, alpha subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGTGAACTGTTGTGGGGGGTTGAGG |
| Internal bar code: | CGGGTTCGGTCTGCAACACCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 99.0786 |
| LEAP-Seq n confirming: | 1613 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAACTCCTCCCACACACC |
| Suggested primer 2: | TCCGTCATCATCGACCACTA |