| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.197218 |
| Chromosome: | chromosome 12 |
| Location: | 7317308 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557400 | (1 of 1) K10838 - xeroderma pigmentosum group C-complementing protein (XPC) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAGGAGTTCTGATTCGCGTGAGCGGGGT |
| Internal bar code: | CTTGGCGGGCCACTACAAACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 618 |
| LEAP-Seq percent confirming: | 97.6089 |
| LEAP-Seq n confirming: | 11471 |
| LEAP-Seq n nonconfirming: | 281 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCCCACCAACAACCTGTA |
| Suggested primer 2: | AGCCTGCTCACCAGAATCAT |