| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.197306 |
| Chromosome: | chromosome 9 |
| Location: | 3157246 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387097 | (1 of 41) PTHR10157 - DOPAMINE BETA HYDROXYLASE RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGAGTGGCTGCAGCAGCAAGGCTACGG |
| Internal bar code: | TCCGAATCCCCGCATCCGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 221 |
| LEAP-Seq percent confirming: | 99.7731 |
| LEAP-Seq n confirming: | 1319 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCACTCGGTATCACTTGC |
| Suggested primer 2: | CGGGTGGTTATCAGTTTGCT |