Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.197394 |
Chromosome: | chromosome 17 |
Location: | 510840 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g699500 | TTLL9,Tpg1,TTL8,FAP267 | (1 of 1) K16603 - tubulin polyglutamylase TTLL9 [EC:6.-.-.-] (TTLL9); Tubulin-Tyrosine Ligase 9 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTGAGCAGCTGTGCCGTGTGGAGAGCCG |
Internal bar code: | GGGAGCTATTAGAGGTGGCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 603 |
LEAP-Seq percent confirming: | 99.7955 |
LEAP-Seq n confirming: | 488 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCACCCACGCTGTACAAGA |
Suggested primer 2: | AACACCTCTCCAACCCTCCT |