| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.197441 |
| Chromosome: | chromosome 16 |
| Location: | 6356613 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674050 | ADH12 | Alcohol dehydrogenase; (1 of 1) 1.6.5.5 - NADPH:quinone reductase / Zeta-crystallin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCCACTTGGCCGAAGCGCGTGCGCAGG |
| Internal bar code: | GGTGCATGTCCTACGGGGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 135 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 406 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGTGGTGGGGTAGTGCTG |
| Suggested primer 2: | TTCACGCTTACGCTCATTTG |