| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.197511 |
| Chromosome: | chromosome 7 |
| Location: | 2524290 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329700 | NSG9,RPT2 | 26S proteasome regulatory subunit; (1 of 1) K03062 - 26S proteasome regulatory subunit T2 (PSMC1, RPT2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCTCTGGCTCCCACACTTTCCTTCAAT |
| Internal bar code: | TGTTTGCGCCGTTCCTTGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 598 |
| LEAP-Seq percent confirming: | 99.6904 |
| LEAP-Seq n confirming: | 322 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTGAGGCTGAATGCGACT |
| Suggested primer 2: | GTGTGCCGTACATGGACTTG |