Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.197597 |
Chromosome: | chromosome 12 |
Location: | 7531575 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555750 | CPK7 | (1 of 13) PTHR10584 - SUGAR KINASE; putative carbohydrate kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTCCCTACCACACAGCCCCCAGTCTATA |
Internal bar code: | GCATTTAACCTGTACCCCCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1021 |
LEAP-Seq percent confirming: | 99.6068 |
LEAP-Seq n confirming: | 5826 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGACTTGCCAAACGATACC |
Suggested primer 2: | GAGATGTGGCGTTCTGGATT |