| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197617 |
| Chromosome: | chromosome 14 |
| Location: | 176209 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608800 | NOL1,SDR24 | (1 of 1) 1.1.1.294 - Chlorophyll(ide) b reductase / Chlorophyll b reductase; Chlorophyll b reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCCTTCCCATGTACCCTGTGCTCTGCTA |
| Internal bar code: | CCGTGACAGTTGGGTGCGGAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 27 |
| LEAP-Seq percent confirming: | 98.8506 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCATGTTGAAGATGTGG |
| Suggested primer 2: | GGAGGGACTAGAACCGGAAG |