| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.197618 |
| Chromosome: | chromosome 4 |
| Location: | 1367075 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214502 | UGE,DIV113,UGE1,EZY4 | (1 of 1) 5.1.3.2//5.1.3.5 - UDP-glucose 4-epimerase / Uridine diphospho-galactose-4-epimerase // UDP-arabinose 4-epimerase; UDP-D-glucose/UDP-D-galactose 4-epimerase 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGGGTGTGACAGGTTTGGAAGCTCCG |
| Internal bar code: | TGCGGTTTTTTTCATCATCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 664 |
| LEAP-Seq percent confirming: | 99.5711 |
| LEAP-Seq n confirming: | 1625 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTGTACGCACTCACCACC |
| Suggested primer 2: | GCGCCAATTTATTCTGCATT |