| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197643 |
| Chromosome: | chromosome 10 |
| Location: | 2305799 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434650 | CTR3 | Copper transport accessory protein; (1 of 1) PTHR12483//PTHR12483:SF27//PTHR12483:SF34 - SOLUTE CARRIER FAMILY 31 COPPER TRANSPORTERS // COPPER TRANSPORTER 1A, ISOFORM C-RELATED // PROTEIN P80 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCCCGCCATCCCCAAGTGAGTGGCGGC |
| Internal bar code: | GCGACATCCTCTGCTAGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 98.5163 |
| LEAP-Seq n confirming: | 4847 |
| LEAP-Seq n nonconfirming: | 73 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTACGTGTACCCTGACGC |
| Suggested primer 2: | CCGCACAGTATCCACATCAC |