| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.197661 |
| Chromosome: | chromosome 16 |
| Location: | 5839988 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677800 | (1 of 1) PTHR21530//PTHR21530:SF1 - PHEROMONE SHUTDOWN PROTEIN // TRAB FAMILY PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTAGGCCTGTAGCTGGCTGTAGGCCTGT |
| Internal bar code: | CTGGCCCCATTAGTATAAGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 804 |
| LEAP-Seq percent confirming: | 99.9547 |
| LEAP-Seq n confirming: | 2205 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGATAACAGCAGAGGGG |
| Suggested primer 2: | ACTAGTTGAGCCCGAGCAAA |