| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.197672 |
| Chromosome: | chromosome 3 |
| Location: | 6326184 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193500 | TGL8,CGLD15,PGD1,PML1 | (1 of 2) PTHR21493//PTHR21493:SF124 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // SUBFAMILY NOT NAMED; Plastid galactoglycerolipid degredation 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCACATGGCTAATAGAAGAGGCACACTC |
| Internal bar code: | TGTTCTTTCGGTCGCTCCTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 446 |
| LEAP-Seq percent confirming: | 99.2255 |
| LEAP-Seq n confirming: | 1153 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTCAGCCTTATTACGGT |
| Suggested primer 2: | GCTACTGGATCAGCTACCGC |