| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.197908 |
| Chromosome: | chromosome 9 |
| Location: | 5484532 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400330 | ALK6 | Aurora-like kinase; (1 of 19) K08850 - aurora kinase, other [EC:2.7.11.1] (AURKX) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAGGCAGGGCGCCTCATAGCCCCGGTC |
| Internal bar code: | TGACCCGGGCTCGTACGGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 67.7966 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTACAACTCGGCTTTCAC |
| Suggested primer 2: | AAATATTTGTACCGGCAGCG |