| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.198069 |
| Chromosome: | chromosome 1 |
| Location: | 5513619 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g038950 | SELF1,SELENOF | SelF/SelM homolog; (1 of 1) PTHR13077:SF6 - 15 KDA SELENOPROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGCGGTTCGGGGTGCGTGGGGCGCGTA |
| Internal bar code: | GGTCGTCTATACTGCGCCCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1077 |
| LEAP-Seq percent confirming: | 99.5518 |
| LEAP-Seq n confirming: | 2221 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACCGTGGTACACCTGCTC |
| Suggested primer 2: | AACAAACAGCGAATATCGGG |