| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.198147 |
| Chromosome: | chromosome 16 |
| Location: | 3814285 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689600 | MIA2,FAP73 | (1 of 2) PF13863 - Domain of unknown function (DUF4200) (DUF4200); MIA2 subunit of the modifier of inner arms (MIA) complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCGCCCCGACATCCCGAGGCCTTTCTTA |
| Internal bar code: | TACGTAATACGGGGTACTGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1095 |
| LEAP-Seq percent confirming: | 99.3569 |
| LEAP-Seq n confirming: | 2472 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGACCACAAGGATGAGGA |
| Suggested primer 2: | GGAAGGCTAGATGCACGAAG |