| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198223 |
| Chromosome: | chromosome 7 |
| Location: | 5583064 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351750 | (1 of 1) K14823 - rRNA-processing protein EBP2 (EBP2, EBNA1BP2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTAAGGAAGGCGTTTTCGCGTATCGCCC |
| Internal bar code: | ACGTTGATTTTGGCAGCGGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 233 |
| LEAP-Seq percent confirming: | 98.4966 |
| LEAP-Seq n confirming: | 2293 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGCAAGCAAACAGTCTC |
| Suggested primer 2: | GAACACCTCCTCCAAGGACA |