| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198261 |
| Chromosome: | chromosome 7 |
| Location: | 730877 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317650 | (1 of 1) PTHR11926:SF207 - UDP-GLYCOSYLTRANSFERASE SUPERFAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGCAGGGCATCGAGCACTGACACGCAT |
| Internal bar code: | AACTGGGTAGTCGGGAGTGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 744 |
| LEAP-Seq percent confirming: | 77.1215 |
| LEAP-Seq n confirming: | 2063 |
| LEAP-Seq n nonconfirming: | 612 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGTAGCGCTGTTGACAC |
| Suggested primer 2: | CAAAGCACACGAGGCAAGTA |