Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.198272 |
Chromosome: | chromosome 10 |
Location: | 2633892 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g437400 | (1 of 12) 2.7.11.18 - [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAACTTAGCGCCCTCAGAATGGTTGAAAC |
Internal bar code: | GACTCGCGGCGGTGTCGTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 998 |
LEAP-Seq percent confirming: | 98.5021 |
LEAP-Seq n confirming: | 5458 |
LEAP-Seq n nonconfirming: | 83 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTCCGGCAACTAAAACCA |
Suggested primer 2: | GGTTGGGAGTATCGCTTTGA |