| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.198276 |
| Chromosome: | chromosome 5 |
| Location: | 1576030 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243451 | (1 of 2) K06287 - septum formation protein (maf) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGAATGCGGCTGTCAAAGCGCAGGTCGA |
| Internal bar code: | CGAGCCGGTCGGGGTAAGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 77.9994 |
| LEAP-Seq n confirming: | 2659 |
| LEAP-Seq n nonconfirming: | 750 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGAGCTGCTGGGTAGTT |
| Suggested primer 2: | ATGTCAGTGTCTGGGAAGGG |