| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.198403 |
| Chromosome: | chromosome 3 |
| Location: | 2565006 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160350 | ANK7 | (1 of 1) PF07714//PF12796 - Protein tyrosine kinase (Pkinase_Tyr) // Ankyrin repeats (3 copies) (Ank_2); Predicted protein with ankyrin repeats | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGCAAAGTGTGGTGCGCCGTTACCCC |
| Internal bar code: | TGGTGTGCGTAACCGCAATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 153 |
| LEAP-Seq percent confirming: | 99.7825 |
| LEAP-Seq n confirming: | 1835 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGCTGCAACCAAGTAAG |
| Suggested primer 2: | ATCCTGACACTGCTAACGCC |