| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.198443 |
| Chromosome: | chromosome 2 |
| Location: | 6521845 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116700 | PTK11 | (1 of 37) 2.7.11.17 - Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase; Protein tyrosine kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTGCGCATGCGGTACATGCATAAAAGC |
| Internal bar code: | GTTGAGACTCGGTTTCGCCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 276 |
| LEAP-Seq percent confirming: | 98.4456 |
| LEAP-Seq n confirming: | 190 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTCTCACTGCTCCTCCC |
| Suggested primer 2: | CACCTCCAAAGAAGGCACAT |