| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.198513 |
| Chromosome: | chromosome 7 |
| Location: | 3759224 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338150 | RNP1,ChlMEI2g,MEI2,AML1 | MEI2 RNA binding protein; (1 of 2) K17579 - protein phosphatase 1 regulatory subunit 42 (PPP1R42, LRRC67) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGTTGGGAGCGGTCCGCGTGCAGTCCG |
| Internal bar code: | GCCAACTCGTGTTAGGCGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 952 |
| LEAP-Seq percent confirming: | 99.3015 |
| LEAP-Seq n confirming: | 2559 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGTGATGTACAGGCACGG |
| Suggested primer 2: | GGGTGTGAGGAACTATGCGT |