| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.198574 |
| Chromosome: | chromosome 3 |
| Location: | 254195 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144444 | (1 of 1) IPR022416 - Prion/Doppel protein, beta-ribbon domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAAGCACGCGGCGGCGGTGGGGGCGCGG |
| Internal bar code: | TGGTGATGGATAGTTTGGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 796 |
| LEAP-Seq percent confirming: | 99.5378 |
| LEAP-Seq n confirming: | 1938 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCATGTCCAACGTCAATGC |
| Suggested primer 2: | CAATCACCCACTGCAATGAC |