| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.198883 |
| Chromosome: | chromosome 6 |
| Location: | 2094573 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265100 | (1 of 1) PF00005//PF16326 - ABC transporter (ABC_tran) // ABC transporter C-terminal domain (ABC_tran_CTD); Soluble ABC-F domain containing protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGGTCTGGAATGACTCGCTAGTATAA |
| Internal bar code: | TGCACGTCCTGGGTCTGGAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 542 |
| LEAP-Seq percent confirming: | 99.6845 |
| LEAP-Seq n confirming: | 5055 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCATTTCTACTGCGACTG |
| Suggested primer 2: | CTCCGCTCGTTTTCGTTTAG |