| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198888 |
| Chromosome: | chromosome 4 |
| Location: | 2469601 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g221700 | COX3 | Mitochondrial cytochrome c oxidase subunit III; (1 of 1) K02262 - cytochrome c oxidase subunit 3 (COX3) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACAAAAGCCAAATGCGGTCCCAGCTGCT |
| Internal bar code: | GGACTCGCCATTGTCGAGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 793 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAGAAATTTGGATTGCGG |
| Suggested primer 2: | ACAAAATGTGCACCAGGACA |