| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198955 |
| Chromosome: | chromosome 3 |
| Location: | 467808 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145107 | (1 of 3) K10406 - kinesin family member C2/C3 (KIFC2_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGCGGCACAGCACGCGGATGTTGCCCTT |
| Internal bar code: | TGTGAATCGGATTTAGACCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1072 |
| LEAP-Seq percent confirming: | 98.9939 |
| LEAP-Seq n confirming: | 3247 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGATCTTGAGTTCCAAGC |
| Suggested primer 2: | GGTTCGTGTGTTGTGTCTGG |