| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198982 |
| Chromosome: | chromosome 7 |
| Location: | 911981 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318950 | (1 of 1) IPR000008//IPR000104//IPR003072 - C2 domain // Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTTGTGCAGCAGCAACGCCACTTGCACA |
| Internal bar code: | ATACCCATTCGGTGCGAAACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 243 |
| LEAP-Seq percent confirming: | 99.1052 |
| LEAP-Seq n confirming: | 4209 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGAGCAGCTGTGTGAG |
| Suggested primer 2: | TCGCATGTCAAGTCTAACGC |