Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199069 |
Chromosome: | chromosome 14 |
Location: | 553946 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611700 | PLAP8,PLP8 | Plastid lipid associated protein 8; (1 of 1) PF01476//PF04755 - LysM domain (LysM) // PAP_fibrillin (PAP_fibrillin) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACTGAGCGCGTTTCTTCCTTCTTACAC |
Internal bar code: | CGGGTTTGCTGATGTGTAGAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 395 |
LEAP-Seq percent confirming: | 99.6585 |
LEAP-Seq n confirming: | 3502 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGGACAGTAATCGCCACAA |
Suggested primer 2: | TGGCTACTCCCTGACAAACC |