Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199072 |
Chromosome: | chromosome 2 |
Location: | 5985685 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g112200 | TRP22 | (1 of 1) IPR001680//IPR005821//IPR011045//IPR017986//IPR020683 - WD40 repeat // Ion transport domain // Nitrous oxide reductase, N-terminal // WD40-repeat-containing domain // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCCGCTGTCCTTGGCTCCGCTGTCGCG |
Internal bar code: | CTACCACAATTAGATTAACAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 675 |
LEAP-Seq percent confirming: | 90.2814 |
LEAP-Seq n confirming: | 3112 |
LEAP-Seq n nonconfirming: | 335 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATATGTGCACGCAAGGAGC |
Suggested primer 2: | CTTTAATTCTCGCAGTCGGC |