| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199095 |
| Chromosome: | chromosome 17 |
| Location: | 2593984 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716900 | (1 of 1) IPR002104//IPR010998//IPR011010 - Integrase, catalytic domain // Integrase, Lambda-type, N-terminal // DNA breaking-rejoining enzyme, catalytic core | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGCCGTCGCTTCTTGTTCCTCGAGTTG |
| Internal bar code: | TGCTAAGCGCTCAGGGACGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 668 |
| LEAP-Seq percent confirming: | 99.7312 |
| LEAP-Seq n confirming: | 371 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATGTCGTTGATGATGCC |
| Suggested primer 2: | AAGGAAAGACTGACCAGGCA |