Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199202 |
Chromosome: | chromosome 13 |
Location: | 3046896 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g584450 | (1 of 6) PTHR27000:SF160 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN DDB_G0281931-RELATED | CDS|intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGGAAAAAGGGCCACGCCCCCACGGTA |
Internal bar code: | AGAACTGCAAGATCACGGCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1010 |
LEAP-Seq percent confirming: | 99.2147 |
LEAP-Seq n confirming: | 4801 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCATAGGGCGTTGGTATTG |
Suggested primer 2: | ACGGTCTTCAAAACACGACC |