| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199207 |
| Chromosome: | chromosome 6 |
| Location: | 6191469 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g290500 | GEX63 | (1 of 1) K08333 - phosphoinositide-3-kinase, regulatory subunit 4 (PIK3R4, VPS15) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTATTTCACCTCTTCCCTCCTCGCCAAC |
| Internal bar code: | AGGCCGGTATTGCCCGGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 42 |
| LEAP-Seq percent confirming: | 94.837 |
| LEAP-Seq n confirming: | 349 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGCTATGCCTTCACTTC |
| Suggested primer 2: | CATGCTATCCCTCCCTCAGA |