| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199209 |
| Chromosome: | chromosome 3 |
| Location: | 4864846 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179300 | SRH6 | (1 of 1) K11367 - chromodomain-helicase-DNA-binding protein 1 [EC:3.6.4.12] (CHD1); SNF2-related DNA/RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCTGTCCCACACACCCACCGCCATAGC |
| Internal bar code: | CAGTAATGTCGACTAGGTAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 220 |
| LEAP-Seq percent confirming: | 95.8747 |
| LEAP-Seq n confirming: | 1255 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGCTAAACTGTCTTGCC |
| Suggested primer 2: | TCTCTGTGGCATGTCTCTGG |