| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.199260 |
| Chromosome: | chromosome 2 |
| Location: | 7330569 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145150 | MAM3A | (1 of 5) K16302 - metal transporter CNNM (CNNM); Protein putatively involved in mitochondrial biogenesis | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACAGCTGATCGGCTACCCCGCTTTGCCG |
| Internal bar code: | CACCGTGTGTAGCTGGGTATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1040 |
| LEAP-Seq percent confirming: | 65.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATTTCGTGATTTCGGG |
| Suggested primer 2: | GAGAAACAGAGCCAACAGGC |