| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.199314 |
| Chromosome: | chromosome 13 |
| Location: | 4182359 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592200 | GLT1,GSN1 | Glutamate synthase, NADH-dependent; (1 of 1) 1.4.1.14 - Glutamate synthase (NADH) / NADH-glutamate synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAAAACGTTAAGATCATTCGCGTTCCA |
| Internal bar code: | GCCGGAGGTTATTTGGGTGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 481 |
| LEAP-Seq percent confirming: | 98.9996 |
| LEAP-Seq n confirming: | 2573 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTCCTGACTGCCAACACC |
| Suggested primer 2: | CAGCATATGGTACCGCACAC |